Primer Map

Enter the primers you want to display. An example primer entry is: (T7) aatacgactcactatag. The round brackets surround the name of the primer; the sequence is written 5' to 3'; Multiple entries are separated by commas.

(reverse) aacagctatgaccatg, (T3) attaaccctcactaaag, (KS) cgaggtcgacggtatcg, (SK) tctagaactagtggatc, (T7) aatacgactcactatag, (-40) gttttcccagtcacgac, (Sp6) atttaggtgacactatag, (M13 for) gtaaaacgacggccagt, (M13 rev) cacacaggaaacagctatgaccat, (BGH rev) tagaaggcacagtcgagg, (pGEX for) ctggcaagccacgtttggtg, (pGEX rev) ggagctgcatgtgtcagagg, (T7-EEV aaggctagagtacttaatacga, (pUC/M13 Forward) gttttcccagtcacgac, (pUC/M13 forward) cgccagggttttcccagtcacgac, (pUC/M13 reverse) caggaaacagctatgac, (pUC/M13 reverse) tcacacaggaaacagctatgac, (Glprimer1) tgtatcttatggtactgtaactg, (GLprimer2) ctttatgtttttggcgtcttcca, (RVprimer3) ctagcaaaataggctgtccc, (RVprimer4) gacgatagtcatgccccgcg, (Lambda gt11 Forward) ggtggcgacgactcctggagcccg, (Lambda gt11 Reverse) ttgacaccagaccaactggtaatg, (Lambda gt10 Forward) cttttgagcaagttcagcctggttaag, (lambda gt10 Reverse) gaggtggcttatgagtatttcttccagggta, (Pinpoint Sequencing) cgtgacgcggtgcagggcg, (pTarget Sequencing) ttacgccaagttatttaggtgaca

Bases per line:

Reading frame: Genetic code:

Restriction sites:

Sequences:

Paste the sequences either as raw data (IUPAC code) or as one or more FASTA sequences. Input limit is 100000 characters.

The Web Bench

The Web Bench is the essential companion to the biologist, bringing informational resources and a collection of tools & calculators to facilitate work at the bench and analysis of biological data.
Check out the full online bench here

Sequence Analysis with GenBeans

Try GenBeans: Best free software for DNA sequence editing!

FEEDBACK

Your comments & your suggestionsare appreciated. Please, notify us for resources and tools that you would like to see on this bench!

Bookmark this page!